pGB CIAP-2 siRNA Vector Mix

Catalog number
pGB CIAP-2 siRNA Vector Mix
60 μg
1023.00 EUR


• GeneBlocker™ cIAP-2 siRNA Vector Mix • Application- The pGB siRNA vector Mix (1 µg/µl) can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked. • Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.
Storage condition
Shipping condition
gel pack
Maximum time for storage
12 months